Psychrobacillus glaciei: PB01_06500 Help Entry PB01_06500        CDS       T06231                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism psyo  Psychrobacillus glaciei Pathway psyo01100   Metabolic pathways psyo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:psyo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PB01_06500    00074 Mycolic acid biosynthesis     PB01_06500   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PB01_06500 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  QFF98504 UniProt:  A0A5J6SP15 LinkDB All DBs Position 1459539..1459775 Genome browser AA seq 78 aa AA seqDB search MSTVLERVKKVVVDRLGVDESEVKLEASFRDDLGADSLDVVELVMELEDEFDMEISDEDA ENISTVGSAVSYIESKQG NT seq 237 nt NT seq  +upstreamnt  +downstreamnt gtgtcaacagttttagaacgcgtaaaaaaagtagtggtagatcgtctaggtgtcgatgaa agcgaagtaaaattagaagcgtctttccgtgatgatttaggtgctgactctcttgatgta gtagaattagtaatggaacttgaagatgagttcgatatggaaatttcagatgaagatgct gaaaacatttcaactgtaggtagtgcagttagctatattgaaagcaaacaaggctaa

DBGET integrated database retrieval system