Paenibacillus terrae: HPL003_17960 Help Entry HPL003_17960      CDS       T01668                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pta  Paenibacillus terrae Pathway pta00998   Biosynthesis of various antibiotics pta01100   Metabolic pathways pta01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pta00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     HPL003_17960 (acpP)    00074 Mycolic acid biosynthesis     HPL003_17960 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     HPL003_17960 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  AET60336 UniProt:  G7W109 LinkDB All DBs Position 3829992..3830225 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgacgtattggagcgcgtaaaacgcattgtcgttgaccgtttgggagccgacgaa gccgaagttacacttgaagcatctttcaaagatgatttaggcgctgattctctcgatgta gttgaattggttatggaattggaagatgagtttgatatggaaatctctgatgaagatgca gagaaaattacaaccgtaggtgaagttgtaaagtacatacaatctcatacctaa

DBGET integrated database retrieval system