Paenibacillus taichungensis: ACJYJG_11415 Help Entry ACJYJG_11415      CDS       T11411                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ptac  Paenibacillus taichungensis Pathway ptac00998   Biosynthesis of various antibiotics ptac01100   Metabolic pathways ptac01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ptac00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ACJYJG_11415 (acpP)    00074 Mycolic acid biosynthesis     ACJYJG_11415 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ACJYJG_11415 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  XLM67627 LinkDB All DBs Position 2441747..2441980 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKEDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcatcgtcgtcgaccgcttgggcgcagacgaa gctgaagttacacttgaagcatctttcaaagaagatttgggtgctgattctttggatgta gtggaattggtcatggaattggaagatgaattcgatttggaaatctctgatgaagatgca gaaaaaatcacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system