Paenibacillus tritici: KDC22_15265 Help Entry KDC22_15265       CDS       T07560                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ptri  Paenibacillus tritici Pathway ptri00998   Biosynthesis of various antibiotics ptri01100   Metabolic pathways ptri01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ptri00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     KDC22_15265    00074 Mycolic acid biosynthesis     KDC22_15265   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     KDC22_15265 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  QUL57718 LinkDB All DBs Position 3564890..3565123 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA ESITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcattgtcatcgaccgcttaggtgccgatgaa gcagaggtaacattagaagcgtctttcaaagatgatttaggtgctgattctcttgacgta gtagaattggtaatggaattggaagatgaattcgatatggaaatctctgatgaagatgca gagagtattacgaccgtgggtgaagttgtgaagtacatacaatctcatacctag

DBGET integrated database retrieval system