Pandoraea thiooxydans: ABW99_06235 Help Entry ABW99_06235       CDS       T03947                                  Name (GenBank) DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism ptx  Pandoraea thiooxydans Brite KEGG Orthology (KO) [BR:ptx00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:ptx03032]     ABW99_06235    03036 Chromosome and associated proteins [BR:ptx03036]     ABW99_06235    03400 DNA repair and recombination proteins [BR:ptx03400]     ABW99_06235 DNA replication proteins [BR:ptx03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     ABW99_06235 Chromosome and associated proteins [BR:ptx03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     ABW99_06235 DNA repair and recombination proteins [BR:ptx03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       ABW99_06235 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 DUF7342 Motif Other DBs NCBI-ProteinID:  AKJ67873 UniProt:  A0A0G3ELD6 LinkDB All DBs Position 2152175..2152447 Genome browser AA seq 90 aa AA seqDB search MNKTELIDHIADKADISKAAAGRALDALVGAVKTTLKKGGSVTLVGFGTFAVGKRAARTG RNPRTGAAIKIKAAKVPKFRPGKALKDALN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt gtgaataaaaccgaactgatcgaccatatcgcggacaaagcagacatttcgaaagcagcc gcaggtcgtgcgctcgacgctttggtaggtgcagtgaaaacgacgctgaaaaaaggtggc agtgtgacgctcgtgggattcggcacgtttgctgtcggcaagcgcgccgcccgcacaggt cgcaacccccgcacaggcgcggcaatcaaaatcaaggcggcaaaggtaccgaaatttcgc cctggcaaagccctgaaagatgcgttaaactga

DBGET integrated database retrieval system