Pandoraea thiooxydans: ABW99_18360 Help Entry ABW99_18360       CDS       T03947                                  Name (GenBank) hypothetical protein   KO K07122   phospholipid transport system transporter-binding protein Organism ptx  Pandoraea thiooxydans Pathway ptx02010   ABC transporters Brite KEGG Orthology (KO) [BR:ptx00001]  09130 Environmental Information Processing   09131 Membrane transport    02010 ABC transporters     ABW99_18360  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02000 Transporters [BR:ptx02000]     ABW99_18360 Transporters [BR:ptx02000]  ABC transporters, prokaryotic type   Saccharide, polyol, and lipid transporters    Phospholipid transporter     ABW99_18360 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  STAS_2 STAS Motif Other DBs NCBI-ProteinID:  AKJ69875 UniProt:  A0A0G3ESB4 LinkDB All DBs Position 302068..302325 Genome browser AA seq 85 aa AA seqDB search MLALQSELTHDTAAAVLRDGMASIDAGETQVDCAALMRFDSSALAVLLALRRHAIRRGAT LAFSNLPDELTSLAQVYGITHLLAN NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgctcgcgctgcaatccgaactgacgcacgacaccgcagccgcggtactgcgtgatggc atggcgtcgatcgacgctggggagacccaggtcgattgcgccgcgctgatgcgtttcgac tcgtcggcgctggcggtattgctggcgttgcggcgacacgcgatccgccgcggcgcgacg ctggccttcagcaatctgcccgacgaattgaccagtctggcacaggtctacgggatcact catttgttggctaactga

DBGET integrated database retrieval system