Neopusillimonas aestuarii: G9Q38_09480 Help Entry G9Q38_09480       CDS       T06486                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism pud  Neopusillimonas aestuarii Brite KEGG Orthology (KO) [BR:pud00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:pud03032]     G9Q38_09480    03036 Chromosome and associated proteins [BR:pud03036]     G9Q38_09480    03400 DNA repair and recombination proteins [BR:pud03400]     G9Q38_09480 DNA replication proteins [BR:pud03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     G9Q38_09480 Chromosome and associated proteins [BR:pud03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     G9Q38_09480 DNA repair and recombination proteins [BR:pud03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       G9Q38_09480 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 HU-CCDC81_euk_2 Motif Other DBs NCBI-ProteinID:  QIM49393 UniProt:  A0A6G8I8E5 LinkDB All DBs Position 1947563..1947835 Genome browser AA seq 90 aa AA seqDB search MNKTELIEHISTKADLSKADAGRALEAFIGAVKTTLKKKGSVTLVGFGTFAVSERAARTG RNPRTGEAIKIKKAKVPKFRPGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaataaaactgagcttatcgagcacatttccaccaaagcagacctttcaaaagccgac gccggtcgcgctctagaggcatttattggtgcagttaaaaccacgcttaaaaagaaaggc agcgttacccttgtgggtttcggtacatttgccgtctccgagcgtgccgcccgtacaggc cgtaatccgcgcactggcgaagcaattaaaatcaaaaaagccaaggtgcccaagttccgt cctggtaaggccctgaaagacgctgttaactaa

DBGET integrated database retrieval system