Providencia vermicola: G3341_05570 Help Entry G3341_05570       CDS       T06449                                  Symbol ccmD Name (GenBank) heme exporter protein CcmD   KO K02196   heme exporter protein D Organism pvc  Providencia vermicola Pathway pvc02010   ABC transporters Brite KEGG Orthology (KO) [BR:pvc00001]  09130 Environmental Information Processing   09131 Membrane transport    02010 ABC transporters     G3341_05570 (ccmD)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02000 Transporters [BR:pvc02000]     G3341_05570 (ccmD) Transporters [BR:pvc02000]  ABC transporters, prokaryotic type   ABC-2 type and other transporters    Heme transporter     G3341_05570 (ccmD) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CcmD UPF0542 Motif Other DBs NCBI-ProteinID:  QIC15202 LinkDB All DBs Position 1299427..1299639 Genome browser AA seq 70 aa AA seqDB search MSSAFASWSDFFAMGGYAFYVWLAVALTITPLLLLCIHTVLQRKMIINSIIAQQAREARQ KAARARREVE NT seq 213 nt NT seq  +upstreamnt  +downstreamnt atgagtagtgcatttgcatcttggagcgatttttttgcgatgggaggctatgcattttat gtatggctagccgtcgccttgacgattaccccattgttgttgctgtgtattcacacggtg ttacaacgaaaaatgataattaactcaattattgcacagcaagcaagagaagcgagacaa aaagcggcacgagcgcgtcgggaggttgagtga

DBGET integrated database retrieval system