Panicum virgatum (switchgrass): 120712285 Help Entry 120712285         CDS       T07260                                  Name (RefSeq) calmodulin-like   KO K02183   calmodulin Organism pvir  Panicum virgatum (switchgrass) Pathway pvir04016   MAPK signaling pathway - plant pvir04070   Phosphatidylinositol signaling system pvir04075   Plant hormone signal transduction pvir04626   Plant-pathogen interaction Brite KEGG Orthology (KO) [BR:pvir00001]  09130 Environmental Information Processing   09132 Signal transduction    04016 MAPK signaling pathway - plant     120712285    04070 Phosphatidylinositol signaling system     120712285    04075 Plant hormone signal transduction     120712285  09150 Organismal Systems   09159 Environmental adaptation    04626 Plant-pathogen interaction     120712285  09180 Brite Hierarchies   09181 Protein families: metabolism    01009 Protein phosphatases and associated proteins [BR:pvir01009]     120712285   09182 Protein families: genetic information processing    04131 Membrane trafficking [BR:pvir04131]     120712285    03036 Chromosome and associated proteins [BR:pvir03036]     120712285   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:pvir04147]     120712285 Protein phosphatases and associated proteins [BR:pvir01009]  Protein serine/threonine phosphatases   Phosphoprotein phosphatases (PPPs)    Calcineurin (PPP3/ PP2B)     Regulatory subunits      120712285 Membrane trafficking [BR:pvir04131]  Exocytosis   Small GTPases and associated proteins    Rab associated proteins     120712285 Chromosome and associated proteins [BR:pvir03036]  Eukaryotic type   Centrosome formation proteins    Centrosome duplication proteins     Centriole replication proteins      120712285 Exosome [BR:pvir04147]  Exosomal proteins   Exosomal proteins of colorectal cancer cells    120712285 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  EF-hand_7 EF-hand_6 EF-hand_1 EF-hand_5 EF-hand_8 DUF5446 DUF5580_M UPF0240 HEM4 EF_EFCAB10_C Motif Other DBs NCBI-GeneID:  120712285 NCBI-ProteinID:  XP_039853976 LinkDB All DBs Position 6K:33945070..33945898 Genome browser AA seq 95 aa AA seqDB search MATVCLRSLGQISTEEELTLLTRHMHEASSADEEELREAFRISDQDQSGFISHDEIRHVL QNLGERLSGLEHCHLNSTCSSSLTAEAAESGSAAC NT seq 288 nt NT seq  +upstreamnt  +downstreamnt atggcgacggtatgcctgcgttcgctggggcagatctcgacagaggaggagctgaccctc ctgacgcgccatatgcatgaggccagcagcgccgacgaggaagagctccgcgaggccttc cgcatctccgaccaggaccagagcggcttcatctcccacgatgagattcgccacgtcctc cagaacctcggcgagcgcctctccggcctcgagcactgccacctcaactccacctgctcc agctcgctcactgctgaggcggccgagtcaggatcagccgcgtgttag

DBGET integrated database retrieval system