Paenibacillus woosongensis: QNH46_10635 Help Entry QNH46_10635       CDS       T09437                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pwn  Paenibacillus woosongensis Pathway pwn00998   Biosynthesis of various antibiotics pwn01100   Metabolic pathways pwn01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pwn00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QNH46_10635 (acpP)    00074 Mycolic acid biosynthesis     QNH46_10635 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QNH46_10635 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  WHX51056 UniProt:  A0A7X2YYC5 LinkDB All DBs Position 2336712..2336945 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgcgtaaaacgcattgtagtggatcgcctcggcgcagatgaa gctgaagtgacgcttgaagcgtctttcaaagatgacctgggtgctgattcgctggatgta gtcgaattggtcatggaactcgaagatgaattcgatttggaaatttcagatgaagatgct gagaagattacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system