Paenibacillus xylanexedens: BS614_14815 Help Entry BS614_14815       CDS       T04676                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pxl  Paenibacillus xylanexedens Pathway pxl01100   Metabolic pathways pxl01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pxl00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BS614_14815    00074 Mycolic acid biosynthesis     BS614_14815   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BS614_14815 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  APO45151 LinkDB All DBs Position 3317294..3317527 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKEDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcatcgtcgtcgaccgcttgggcgcagacgaa gctgaagttacacttgaagcatctttcaaagaagatttgggtgctgattctttggatgta gtggaattggtcatggaattggaagatgaatttgatttggaaatctctgatgaagatgca gaaaaaatcacgaccgtaggtgaagttgtaaactacatacaatctcatacctaa

DBGET integrated database retrieval system