Pseudomonas yamanorum: AK972_4943 Help Entry AK972_4943        CDS       T05821                                  Name (GenBank) DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism pym  Pseudomonas yamanorum Brite KEGG Orthology (KO) [BR:pym00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:pym03032]     AK972_4943    03036 Chromosome and associated proteins [BR:pym03036]     AK972_4943    03400 DNA repair and recombination proteins [BR:pym03400]     AK972_4943 DNA replication proteins [BR:pym03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     AK972_4943 Chromosome and associated proteins [BR:pym03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     AK972_4943 DNA repair and recombination proteins [BR:pym03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       AK972_4943 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 SSPI Motif Other DBs NCBI-ProteinID:  AMW85743 UniProt:  A0A143GN55 LinkDB All DBs Position complement(5460199..5460480) Genome browser AA seq 93 aa AA seqDB search MAITKDQLIADLAESTGATKVQVRAVIEQLSQIVADQLENGGEITLPGVGKLKVTERPAR TGRNPSTGAAIEIAAKKVIKLVVAKSLTDAVNK NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atggctattactaaagaccaactgatcgctgatctggctgaatccactggcgccaccaaa gttcaagtgcgtgcagtgattgaacaactgagccagatcgttgctgatcagctggaaaac ggcggcgaaatcactctgccaggcgttggcaaactgaaagtgaccgagcgtcctgcccgt actggccgtaacccttcgactggcgctgccatcgaaatcgctgccaagaaagttatcaag ctggttgtggcaaaaagcctgaccgacgctgttaacaagtaa

DBGET integrated database retrieval system