Quatrionicoccus australiensis: KI612_09300 Help Entry KI612_09300       CDS       T07598                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism qau  Quatrionicoccus australiensis Pathway qau01100   Metabolic pathways qau01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:qau00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     KI612_09300 (acpP)    00074 Mycolic acid biosynthesis     KI612_09300 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     KI612_09300 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1896 Ribosomal_L50 DUF5783 Motif Other DBs NCBI-ProteinID:  UCV16845 LinkDB All DBs Position 1938939..1939175 Genome browser AA seq 78 aa AA seqDB search MDNIVERVKKIVAEQLGVNEADIKNESSFVDDLGADSLDTVELVMALEEEFETEIPDDQA EKITTVQQAVDFILANKK NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggataacatcgtagagcgcgtcaagaagatcgtcgccgaacaactgggcgtgaacgaa gcggacatcaagaacgagtcctcctttgtggacgatttgggcgctgattccctggatacc gttgagctggtcatggctctggaagaggaattcgagaccgaaatcccggacgaccaagct gaaaagatcacgacggttcaacaggctgtcgatttcatcctcgccaacaagaagtaa

DBGET integrated database retrieval system