Rahnella aceris Y9602: Rahaq_4684 Help Entry Rahaq_4684        CDS       T01422                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism rah  Rahnella aceris Y9602 Pathway rah01100   Metabolic pathways rah01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:rah00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Rahaq_4684    00074 Mycolic acid biosynthesis     Rahaq_4684   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Rahaq_4684 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ADW76264 UniProt:  A0A0H3FGR4 LinkDB All DBs Position pRAHAQ01:244029..244283 Genome browser AA seq 84 aa AA seqDB search MFTSTIIEAIGLVLESSHLSELHAETHLERDLGFESGLYIELIMYLEEKVDGLILDPATL EFEHFETVGSLSRFIQLQLANRAA NT seq 255 nt NT seq  +upstreamnt  +downstreamnt atgtttacttcaacaatcattgaggccatcggcttagtgctggaaagttctcatctctca gaactgcatgcagaaacacatctggaacgcgatttaggctttgaaagcgggctgtatatt gaactgattatgtatctggaagagaaagtcgacgggctgatcctggatccggccacgctg gaatttgagcattttgaaaccgtgggcagcttatcgagattcattcaactgcaactcgcg aaccgggctgcctga

DBGET integrated database retrieval system