Rothia aeria: RA11412_1623 Help Entry RA11412_1623      CDS       T05268                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism raj  Rothia aeria Pathway raj01100   Metabolic pathways raj01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:raj00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     RA11412_1623    00074 Mycolic acid biosynthesis     RA11412_1623   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     RA11412_1623 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L50 DUF2969 Motif Other DBs NCBI-ProteinID:  BAV87922 UniProt:  A0A2Z5QZM1 LinkDB All DBs Position 1501567..1501809 Genome browser AA seq 80 aa AA seqDB search MANKEEILAGLAEIVNEETGVEVEDVQLDKSFTEDLDIDSISMMTIVVNAEEKFEVTIPD EEVKNLKTVGDAVEFIENAS NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atggctaacaaagaagagatccttgctggtctggcagaaatcgtgaacgaagagaccggc gttgaggttgaggacgttcagctggataagtcctttaccgaggacttggacatcgactcc atctcaatgatgactatcgttgtgaacgccgaagagaagttcgaggtgaccatcccggac gaagaggtgaagaaccttaagaccgttggtgacgctgtcgagtttatcgagaacgcctcc taa

DBGET integrated database retrieval system