Aerosticca soli: ALSL_2276 Help Entry ALSL_2276         CDS       T06043                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism rbd  Aerosticca soli Brite KEGG Orthology (KO) [BR:rbd00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:rbd03036]     ALSL_2276 Chromosome and associated proteins [BR:rbd03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     ALSL_2276 SSDB OrthologParalogGFIT Motif Pfam:  ZapB CCDC122 TSC22 GAS T4SS_LegC2C7 CALCOCO1 SPC25_N BAR_3 AKAP9_coil_N Par-4_C Stathmin DUF7491 IPGA1_CC PIBF1 Map3k7cl Dynamitin CCDC18_1st KASH_CCD CC_Bre1 ADIP COG3_N YabA DUF5858 DUF2968 Nup88 APG6_N DUF3450 Plectin_PPL DUF7096 YwqH-like CDK5RAP3 TMF_TATA_bd UPF0242 KfrA_N CLZ Rv0250c Motif Other DBs NCBI-ProteinID:  BBD80902 UniProt:  A0A2Z6E7Y7 LinkDB All DBs Position 2425826..2426050 Genome browser AA seq 74 aa AA seqDB search MSTPRLERELERLNQRIDRLLEALRRLAEENRSLRHSQEQLANERAGLLARNEQARCRVE AMIQRLRSLENNPP NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atgagcacaccccgcctcgagcgcgaactggaacggctcaaccagcgcatcgaccgtctg ctggaggccttgcggcgcctggcggaggagaaccgcagcctgcggcacagccaggagcag ctggccaacgagcgcgccggcctcttggcccgcaacgagcaggcgcgctgccgcgtggag gcgatgatccagcgccttcgctcgctggagaacaacccgccatga

DBGET integrated database retrieval system