Robiginitalea biformata: RB2501_06760 Help Entry RB2501_06760      CDS       T00992                                  Name (GenBank) hypothetical protein   KO K03116   sec-independent protein translocase protein TatA Organism rbi  Robiginitalea biformata Pathway rbi03060   Protein export rbi03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:rbi00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     RB2501_06760  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     RB2501_06760  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:rbi02044]     RB2501_06760 Secretion system [BR:rbi02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    RB2501_06760 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E Motif Other DBs NCBI-ProteinID:  EAR16580 UniProt:  A4CI22 LinkDB All DBs Position 745731..745913 Genome browser AA seq 60 aa AA seqDB search MNALLLFLAIGPWQIAIIVLVVLLLFGGKKIPELMRGLGSGIKEFKDASREDEKLDEKKD NT seq 183 nt NT seq  +upstreamnt  +downstreamnt atgaatgcacttttattattcttagcaattgggccctggcagattgccatcatcgtcctg gtggtattgttgttgttcggcggaaagaaaatccccgagctgatgcgcggattgggcagc gggatcaaagaattcaaggatgcctcccgcgaagacgaaaagctggacgaaaagaaagac tga

DBGET integrated database retrieval system