Robiginitalea biformata: RB2501_13644 Help Entry RB2501_13644      CDS       T00992                                  Name (GenBank) DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism rbi  Robiginitalea biformata Brite KEGG Orthology (KO) [BR:rbi00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:rbi03032]     RB2501_13644    03036 Chromosome and associated proteins [BR:rbi03036]     RB2501_13644    03400 DNA repair and recombination proteins [BR:rbi03400]     RB2501_13644 DNA replication proteins [BR:rbi03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     RB2501_13644 Chromosome and associated proteins [BR:rbi03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     RB2501_13644 DNA repair and recombination proteins [BR:rbi03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       RB2501_13644 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 Nucleoporin_FG2 HU-DNA_bdg Motif Other DBs NCBI-ProteinID:  EAR15375 UniProt:  A4CKH6 LinkDB All DBs Position complement(2279533..2279805) Genome browser AA seq 90 aa AA seqDB search MNKTELIDAMAADAGITKAAAKKALESFLGNVESSLKKGNRVSLVGFGSWSVSRRNAREG RNPSTGKTIHIPAKNVVKFKAGSELGDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaacaaaacagaattaatcgatgccatggcagccgatgccggaatcaccaaagccgca gccaaaaaggcgctggaatctttcctcggaaacgtagagagctctttgaaaaaaggaaac cgcgtttctttagtaggattcggctcctggtctgtttccagaaggaatgctcgcgagggc cgcaacccttctaccgggaaaaccatccatatcccggcaaaaaacgtagtaaagtttaaa gcaggttccgaattaggagatgcggtaaactaa

DBGET integrated database retrieval system