Rouxiella chamberiensis: O1V66_05390 Help Entry O1V66_05390       CDS       T08677                                  Name (GenBank) hypothetical protein   KO K03503   DNA polymerase V [EC:3.4.21.-] Organism rcb  Rouxiella chamberiensis Brite KEGG Orthology (KO) [BR:rcb00001]  09180 Brite Hierarchies   09181 Protein families: metabolism    01002 Peptidases and inhibitors [BR:rcb01002]     O1V66_05390   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:rcb03400]     O1V66_05390 Peptidases and inhibitors [BR:rcb01002]  Serine peptidases   Family S24: LexA family    O1V66_05390 DNA repair and recombination proteins [BR:rcb03400]  Prokaryotic type   TLS (translesion DNA synthesis) factors    Y-family DNA polymerases     O1V66_05390 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  DUF6333 Motif Other DBs NCBI-ProteinID:  WAT02106 UniProt:  A0ABY7HRR9 LinkDB All DBs Position 1125173..1125325 Genome browser AA seq 50 aa AA seqDB search MARLESLDNPEEVRLIARSDLEGSETIVWGVVTHIINDASTDEFDDCPLI NT seq 153 nt NT seq  +upstreamnt  +downstreamnt gtggcgcgcctcgagtcgctggacaatcccgaagaggtccggttaatcgctaggagcgat ttggaaggaagcgaaactatcgtgtggggcgtggtgacgcatatcatcaatgatgcaagc accgatgagtttgacgactgcccgcttatctaa

DBGET integrated database retrieval system