Rhizorhabdus dicambivorans: CMV14_06345 Help Entry CMV14_06345       CDS       T05084                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism rdi  Rhizorhabdus dicambivorans Pathway rdi01100   Metabolic pathways rdi01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:rdi00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CMV14_06345    00074 Mycolic acid biosynthesis     CMV14_06345   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CMV14_06345 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ATE67175 UniProt:  A0A2A4FZ48 LinkDB All DBs Position complement(1335707..1335976) Genome browser AA seq 89 aa AA seqDB search MGTAGSSSIEDIVRAVLVDALALDPARAAGFDADTGLFGSLPELDSMAVAGLLTELEDRL DIIIDDDEVDGEMLESFGALVRFVETKKG NT seq 270 nt NT seq  +upstreamnt  +downstreamnt gtgggcactgccggttccagcagcatcgaggatatcgtccgcgcggtgctcgtcgacgcc ctggcgctcgatcccgcccgcgccgccggtttcgatgcagataccggcctgttcggatcg ctgcccgaactcgattcgatggcggtcgccggcctgctgaccgaactggaggaccggctc gacatcatcatcgacgatgacgaggtcgatggcgagatgctggagagcttcggcgcgctg gtgcgcttcgtcgagacgaagaagggctag

DBGET integrated database retrieval system