Roseateles depolymerans: RD2015_2000 Help Entry RD2015_2000       CDS       T04166                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism rdp  Roseateles depolymerans Brite KEGG Orthology (KO) [BR:rdp00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:rdp03036]     RD2015_2000 Chromosome and associated proteins [BR:rdp03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     RD2015_2000 SSDB OrthologParalogGFIT Motif Pfam:  ZapB ZapB_rel DUF8429 Cep57_CLD_2 DUF4164 CC_Bre1 BEGAIN_coil SNAPC5 Rootletin CCDC106 Transcrip_act DUF2205 bHLH_IRO3 TPR_MLP1_2 YabA HALZ PAH Motif Other DBs NCBI-ProteinID:  ALV06476 UniProt:  A0A0U3MG54 LinkDB All DBs Position complement(2348266..2348484) Genome browser AA seq 72 aa AA seqDB search MPSLNDLVDRVERLLVRHEELTRTNALLQEQVQALTVERDSLRSRLAAARARVDALLDRL PLESSDSQKSGT NT seq 219 nt NT seq  +upstreamnt  +downstreamnt atgcccagcctgaacgaccttgtcgatcgtgtggagcgcctgcttgtgcgccatgaagag ctcacgcggaccaatgcgctgctgcaggaacaggtgcaggccctgacggtggagcgtgac agcctgcgctcgcgcctggccgccgcacgggcccgggtggatgcactgctggaccgcctg cccctcgaatcctctgactcgcaaaagagcggcacatga

DBGET integrated database retrieval system