Rhodanobacter glycinis: CS053_15310 Help Entry CS053_15310       CDS       T06136                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism rgl  Rhodanobacter glycinis Brite KEGG Orthology (KO) [BR:rgl00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:rgl03036]     CS053_15310 Chromosome and associated proteins [BR:rgl03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     CS053_15310 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  DUF7491 ZapB Syntaxin Mod_r TSC22 Tropomyosin Nup88 GAS HAP1_N YabA bZIP_2 COG3_N DUF2203 UPF0449 TMF_DNA_bd SHE3 TMF_TATA_bd BRE1 EMP24_GP25L KfrA_N SlyX DUF2721 Motif Other DBs NCBI-ProteinID:  QEE25719 UniProt:  A0A1I3ZW44 LinkDB All DBs Position 3446205..3446429 Genome browser AA seq 74 aa AA seqDB search MSTPDSIQHEVAALSQQLDRMLDIVRRLHEENRSLRHSQEQLANERAGLMARNEQARGRV EAMIQRLKALESNG NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atgagcacgcccgattccattcagcacgaggtcgccgcactgagccagcagctcgatcgc atgctggacatcgtgcgacgactccacgaggaaaaccgcagcctgcgccacagccaggaa caactggccaacgagcgcgccgggctgatggcccgcaacgagcaggcgcgcggccgcgtc gaggcgatgatccagcgactgaaggcgctcgaaagcaatggctga

DBGET integrated database retrieval system