Romboutsia ilealis: CRIB_961 Help Entry CRIB_961          CDS       T09982                                  Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism ril  Romboutsia ilealis Pathway ril01100   Metabolic pathways ril01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ril00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CRIB_961    00074 Mycolic acid biosynthesis     CRIB_961   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CRIB_961 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 DUF7744 RRM_9 Motif Other DBs NCBI-ProteinID:  CED93712 UniProt:  A0A1V1I0E4 LinkDB All DBs Position 1:1027441..1027671 Genome browser AA seq 76 aa AA seqDB search MILNKVKEIMMENLSIEEESITLESTFESLEIDSLDVFQLVMEVEEAFEIQIENPENMKT IKDLVNYIEEKTKVNA NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atgatattaaacaaagttaaagaaataatgatggaaaacttatcaatagaggaggaaagc ataactttagaaagtacattcgaatctttagaaatagattcattagatgtattccaatta gtaatggaagtagaagaagcttttgaaatacaaatagagaacccagaaaatatgaaaact ataaaggatttagtaaactacatagaagaaaaaactaaagtaaatgcttaa

DBGET integrated database retrieval system