Rhodocaloribacter litoris: GQ464_007960 Help Entry GQ464_007960      CDS       T09819                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism rlo  Rhodocaloribacter litoris Pathway rlo01100   Metabolic pathways rlo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:rlo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     GQ464_007960    00074 Mycolic acid biosynthesis     GQ464_007960   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     GQ464_007960 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  QXD16861 LinkDB All DBs Position complement(1934396..1934635) Genome browser AA seq 79 aa AA seqDB search MANDIEAKVKAIIVEKLGVDEDEIKPESSFTNDLGADSLDTVELIMEFEKEFDLTIPDEE AEKIATVGDAIAYLKAKTA NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggcgaacgatatcgaagccaaagtcaaagccatcatcgtggagaagctcggcgtggac gaggacgagatcaagccggaatcgtcgttcacgaacgacctcggcgccgactcgctcgat accgtcgagctgatcatggagttcgagaaggagtttgacctgaccatccccgacgaggag gccgagaagatcgccaccgtcggtgacgcgatcgcgtacctgaaagccaagacggcctga

DBGET integrated database retrieval system