Rhodospirillum rubrum F11: F11_00225 Help Entry F11_00225         CDS       T02006                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism rrf  Rhodospirillum rubrum F11 Pathway rrf01100   Metabolic pathways rrf01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:rrf00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     F11_00225    00074 Mycolic acid biosynthesis     F11_00225   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     F11_00225 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Motif Other DBs NCBI-ProteinID:  AEO46516 LinkDB All DBs Position 46548..46799 Genome browser AA seq 83 aa AA seqDB search MSDVESKIYDIIVEKTNIDRAKLTREASLSELEISSLDFVEIVFAVEEEFDIEVPYNANT QDQDFKALGDIVGAVEKLVEERG NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgagcgacgtcgaaagcaagatctacgatatcatcgtcgaaaagaccaacatcgatcgc gccaaattaacgcgcgaggcgtcgttaagcgaactggaaatctcttcgcttgatttcgtc gagatcgttttcgcggtggaggaggagttcgatatcgaagtcccctacaacgccaatacg caggaccaggatttcaaggccctgggggatattgtcggggccgtcgaaaaactggtcgag gagcggggctga

DBGET integrated database retrieval system