Rana temporaria (common frog): 120917683 Help Entry 120917683         CDS       T07929                                  Name (RefSeq) metallothionein-like   KO K14739   metallothionein 1/2 Organism rtem  Rana temporaria (common frog) Brite KEGG Orthology (KO) [BR:rtem00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:rtem03019]     120917683    03029 Mitochondrial biogenesis [BR:rtem03029]     120917683 Messenger RNA biogenesis [BR:rtem03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      120917683 Mitochondrial biogenesis [BR:rtem03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     120917683 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  120917683 NCBI-ProteinID:  XP_040185083 LinkDB All DBs Position 11:complement(130365618..130371171) Genome browser AA seq 62 aa AA seqDB search MDPHDCNCATGGSCSCGDSCKCKDCKCKGCKKSCCSCCPADCTKCSQGCECAKGCDTCSC CK NT seq 189 nt NT seq  +upstreamnt  +downstreamnt atggaccctcatgactgcaactgtgctacaggtggctcctgctcctgcggtgattcctgc aagtgcaaagactgcaaatgcaagggctgcaagaaaagttgctgctcctgctgtccagca gactgcaccaaatgcagccagggctgtgaatgtgcaaagggatgtgatacctgcagttgt tgcaagtga

DBGET integrated database retrieval system