Rhodanobacter thiooxydans: LRK53_16875 Help Entry LRK53_16875       CDS       T08065                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism rth  Rhodanobacter thiooxydans Brite KEGG Orthology (KO) [BR:rth00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:rth03036]     LRK53_16875 Chromosome and associated proteins [BR:rth03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LRK53_16875 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB GAS DUF7491 TSC22 Tropomyosin YabA CENP-H KASH_CCD Dor1 Syntaxin Taxilin APG6_N DUF3450 Stathmin Mod_r CENP-F_leu_zip DUF2203 COG3_N TMF_DNA_bd DivIC DUF2968 bZIP_2 SlyX DUF4140 Motif Other DBs NCBI-ProteinID:  UJJ56607 LinkDB All DBs Position 3708957..3709196 Genome browser AA seq 79 aa AA seqDB search MSTPEPVQTDPVHQELAALARQLDRLLDTVRRLTEENRSLRQSQEQLSGERAGLLARNEQ ARSRVEAMIQRLKSLENNG NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atgagcacgcccgaacccgtccagaccgatccggtccatcaagagctggccgccttggcc cggcagcttgaccggctgctcgatacggtgcgtcgcctcaccgaggagaaccgcagcctg cgccagagccaggaacagttgtccggcgagcgcgccggcctgctggcgcgcaacgagcag gcccgcagccgcgtcgaggcgatgatccagcggctcaaatcgctagagaacaacggttga

DBGET integrated database retrieval system