Spiractinospora alimapuensis: J4H86_01030 Help Entry J4H86_01030       CDS       T07850                                  Name (GenBank) acyl carrier protein   KO K16025   methoxymalonate biosynthesis acyl carrier protein Organism saiu  Spiractinospora alimapuensis Pathway saiu01051   Biosynthesis of ansamycins saiu01052   Type I polyketide structures Brite KEGG Orthology (KO) [BR:saiu00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01052 Type I polyketide structures     J4H86_01030    01051 Biosynthesis of ansamycins     J4H86_01030  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:saiu01008]     J4H86_01030 Polyketide biosynthesis proteins [BR:saiu01008]  Polyketide tailoring proteins   Others    J4H86_01030 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  QVQ52477 LinkDB All DBs Position 248958..249227 Genome browser AA seq 89 aa AA seqDB search MTTNPTEHATDIESALITFLESKTRGSWDADVDLFSQGGLSSMFAMELVVHLESTYGVSI RGGDLKLDNFRTVRTMADLVRRLRGGESA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgaccaccaaccccaccgagcacgcgaccgacatcgagtccgcgctgatcacctttctg gagtccaagacacgcggctcctgggacgccgacgtcgacctcttcagccagggcggcctg tcctcgatgttcgccatggagctcgtcgtgcacctcgagagcacctacggtgtgtccatc cggggcggcgacctcaagctggacaacttccgcaccgtgcgcacgatggcggacctcgtc cggcgcctgcggggcggggagagtgcgtga

DBGET integrated database retrieval system