Salinarchaeum sp. Harcht-Bsk1: L593_04300 Help Entry L593_04300        CDS       T02693                                  Name (GenBank) 50S ribosomal protein L40e   KO K02927   ubiquitin-large subunit ribosomal protein L40e Organism sali  Salinarchaeum sp. Harcht-Bsk1 Pathway sali03010   Ribosome Brite KEGG Orthology (KO) [BR:sali00001]  09120 Genetic Information Processing   09122 Translation    03010 Ribosome     L593_04300   09123 Folding, sorting and degradation    04120 Ubiquitin mediated proteolysis     L593_04300  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03011 Ribosome [BR:sali03011]     L593_04300    04121 Ubiquitin system [BR:sali04121]     L593_04300 Ribosome [BR:sali03011]  Ribosomal proteins   Eukaryotes    Large subunit     L593_04300   Archaea     L593_04300 Ubiquitin system [BR:sali04121]  Ubiquitins and ubiquitin-like proteins   Ubiquitins    L593_04300 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Ribosomal_L40e Zn_Ribbon_1 DZR DZR_2 Zn_ribbon_RPAB4 DUF7577 Zn_ribbon_3 HypA Motif Other DBs NCBI-ProteinID:  AGN00811 UniProt:  R4VX19 LinkDB All DBs Position 900566..900715 Genome browser AA seq 49 aa AA seqDB search MPKFEAAEDRLLNKAICMRCNARNSPDADRCRKCGHGNLRPKARESRSA NT seq 150 nt NT seq  +upstreamnt  +downstreamnt atgcccaagttcgaagccgcggaagatcgcctgctcaacaaggcgatctgcatgcgatgc aacgcacgaaactccccggacgcggaccgctgccggaagtgcggccacggcaacctccga ccgaaggcccgcgagtcccgctcggcctaa

DBGET integrated database retrieval system