Streptomyces albireticuli: SMD11_0390 Help Entry SMD11_0390        CDS       T05230                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism salj  Streptomyces albireticuli Pathway salj00998   Biosynthesis of various antibiotics salj01100   Metabolic pathways salj01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:salj00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SMD11_0390 (acpP)    00074 Mycolic acid biosynthesis     SMD11_0390 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SMD11_0390 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  ARZ66056 UniProt:  A0A1Z2KVL9 LinkDB All DBs Position 424152..424412 Genome browser AA seq 86 aa AA seqDB search MDRHHVVAAVEAALAEVLERPVTGLTEDVRLFEDLHLDSTSVLEMLMALEDAIDISVDPE SLDMDDFKSVGTLTDYVLSQQAPSGV NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atggaccgtcaccacgtggtcgccgccgtcgaggcggcactcgccgaggtgctggagcgc cccgtcaccgggctcaccgaggacgtacgcctcttcgaggacctgcacctggactccacc tcggtcctggagatgctgatggctctggaggacgccatcgacatctccgtcgacccggag agcctcgacatggacgacttcaagtcggtcggcacgctcaccgactacgtgctctcgcag caggccccgagcggggtgtga

DBGET integrated database retrieval system