Streptomyces albus: SLNWT_5123 Help Entry SLNWT_5123        CDS       T03823                                  Name (GenBank) putative acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism sals  Streptomyces albus Pathway sals00253   Tetracycline biosynthesis sals01056   Biosynthesis of type II polyketide backbone sals01100   Metabolic pathways sals01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sals00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     SLNWT_5123    00253 Tetracycline biosynthesis     SLNWT_5123  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:sals01004]     SLNWT_5123    01008 Polyketide biosynthesis proteins [BR:sals01008]     SLNWT_5123 Lipid biosynthesis proteins [BR:sals01004]  Polyketide synthase   Component type    SLNWT_5123 Polyketide biosynthesis proteins [BR:sals01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      SLNWT_5123     Nonaketide PKS      SLNWT_5123     Decaketide PKS      SLNWT_5123 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AJE85499 UniProt:  A0A0B5EUQ2 LinkDB All DBs Position 5984036..5984305 Genome browser AA seq 89 aa AA seqDB search MATAAFTLDDLKRILLQSAGAAEGVDLDGEILDTEFEVLGYESLALLETGGAIEREYGIS LDDEVITDAETPRALIDAVNAHLSTAGAA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atggccaccgccgcgttcaccctcgacgacctgaagcggatcctgctgcaatccgccggc gccgccgagggcgtcgacctggacggcgagatcctcgacaccgagttcgaggtcctcggc tacgaatccctcgccctcctggagaccggcggcgccatcgagcgcgagtacggcatctcg ctggacgacgaggtcatcaccgacgcggagaccccgcgcgccctcatcgacgccgtcaac gcccacctgtccaccgccggtgcggcctga

DBGET integrated database retrieval system