Streptomyces aquilus: EJC51_31365 Help Entry EJC51_31365       CDS       T07011                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism saqu  Streptomyces aquilus Pathway saqu00253   Tetracycline biosynthesis saqu01056   Biosynthesis of type II polyketide backbone saqu01100   Metabolic pathways saqu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:saqu00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     EJC51_31365    00253 Tetracycline biosynthesis     EJC51_31365  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:saqu01004]     EJC51_31365    01008 Polyketide biosynthesis proteins [BR:saqu01008]     EJC51_31365 Lipid biosynthesis proteins [BR:saqu01004]  Polyketide synthase   Component type    EJC51_31365 Polyketide biosynthesis proteins [BR:saqu01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      EJC51_31365     Nonaketide PKS      EJC51_31365     Decaketide PKS      EJC51_31365 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AZP20176 UniProt:  A0A3Q9C4C8 LinkDB All DBs Position 6769357..6769632 Genome browser AA seq 91 aa AA seqDB search MSQPTFTFDDLKRILLEGSGAPEGGGLDGDAQDVLDTEFSDIGYDSLALLETASRIEREY GIDLDESVIGDATTPRAFIGAVADHLVAPAA NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgtcccagcccacgttcaccttcgacgacctcaagcgcatcctcctcgaaggctccggc gcccccgagggcggcggcctcgacggagacgcccaggacgtcctcgacaccgagttcagc gacatcggctacgactcgctcgctctgctggagaccgccagccgcatcgagcgggagtac ggcatcgacctcgacgagtccgtcatcggcgacgccaccacaccgcgcgccttcatcggc gccgtcgctgaccacctcgtcgcaccggccgcctga

DBGET integrated database retrieval system