Stenotrophomonas aracearum: PDM28_03330 Help Entry PDM28_03330       CDS       T10111                                  Symbol ftsL Name (GenBank) cell division protein FtsL   KO K03586   cell division protein FtsL Organism sarc  Stenotrophomonas aracearum Brite KEGG Orthology (KO) [BR:sarc00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:sarc03036]     PDM28_03330 (ftsL) Chromosome and associated proteins [BR:sarc03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     PDM28_03330 (ftsL) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FtsL DivIC CLLAC DUF3433 Motif Other DBs NCBI-ProteinID:  WNH49377 UniProt:  A0ABY9YES5 LinkDB All DBs Position 739473..739736 Genome browser AA seq 87 aa AA seqDB search MSRLLLVVLLACTIASAIGVVFMRHRHRQTFVELSRVERARDELNIEFGRLQLEQATLAE ATRVDRVARERLGMKFPEAADVVVVRP NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgagccgcctgctgctggtcgtgctgctggcctgcaccatcgcctcggcgatcggtgtg gtgttcatgcgccaccgccatcggcagaccttcgtcgagctgtcgcgcgtggagcgcgcc cgcgacgaactgaacatcgagttcggccgcctgcagctggaacaggcgaccctggccgaa gccacccgcgtcgaccgtgtggcgcgcgagcggctgggcatgaagttcccggaagcggcc gacgtcgtggtggtgcggccatga

DBGET integrated database retrieval system