Natronosalvus rutilus: NGM29_06495 Help Entry NGM29_06495       CDS       T08271                                  Name (GenBank) 30S ribosomal protein S27ae   KO K02977   ubiquitin-small subunit ribosomal protein S27Ae Organism sawl  Natronosalvus rutilus Pathway sawl03010   Ribosome Brite KEGG Orthology (KO) [BR:sawl00001]  09120 Genetic Information Processing   09122 Translation    03010 Ribosome     NGM29_06495   09123 Folding, sorting and degradation    04120 Ubiquitin mediated proteolysis     NGM29_06495  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03011 Ribosome [BR:sawl03011]     NGM29_06495    04121 Ubiquitin system [BR:sawl04121]     NGM29_06495   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:sawl04147]     NGM29_06495 Ribosome [BR:sawl03011]  Ribosomal proteins   Eukaryotes    Small subunit     NGM29_06495   Archaea     NGM29_06495 Ubiquitin system [BR:sawl04121]  Ubiquitins and ubiquitin-like proteins   Ubiquitins    NGM29_06495 Exosome [BR:sawl04147]  Exosomal proteins   Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)    NGM29_06495   Exosomal proteins of colorectal cancer cells    NGM29_06495 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Ribosomal_S27 FYVE Rcat_RNF216 Zn_Ribbon_TF Ribosomal_L37e Zn_ribbon_RPB9 zf-C2H2_FBX41 Zn_ribbon_3 Anti-TRAP Cas12f1-like_TNB DUF7575 HypA zf_UBZ DUF5817 Zn_ribbon_TFIIB Motif Other DBs NCBI-ProteinID:  UTF54900 UniProt:  A0A9E7NBK8 LinkDB All DBs Position 1353077..1353211 Genome browser AA seq 44 aa AA seqDB search MAHYELYNDEGEVEREQCPRCGDSFLADHGDRQHCGKCGYTEWA NT seq 135 nt NT seq  +upstreamnt  +downstreamnt atggcacactacgaactctacaacgacgagggcgaagtcgagcgcgaacagtgcccacgc tgtggggactcgttcctcgccgaccacggcgaccgccagcactgcggcaagtgcggctac accgagtgggcgtaa

DBGET integrated database retrieval system