Shewanella baltica BA175: Sbal175_0353 Help Entry Sbal175_0353      CDS       T02014                                  Name (GenBank) Cell division protein zapB   KO K09892   cell division protein ZapB Organism sbb  Shewanella baltica BA175 Brite KEGG Orthology (KO) [BR:sbb00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:sbb03036]     Sbal175_0353 Chromosome and associated proteins [BR:sbb03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Sbal175_0353 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB KASH_CCD GAS Muted Rootletin NPV_P10 DUF2681 ATG16 YabA Baculo_PEP_C KIP1 Nuf2_DHR10-like ATG14 Prominin Cep57_CLD_2 OmpH FokI_D3 ArsA_ATPase DUF4757 Mis12 DivIC Trimer_CC USHBP1_PDZ-bd SlyX Uso1_p115_C bZIP_2 Motif Other DBs NCBI-ProteinID:  AEG09648 LinkDB All DBs Position complement(397899..398120) Genome browser AA seq 73 aa AA seqDB search MSLELLSKLETKIQAALETIELLKMELEEEKQKASTLSEHNQQLNAQNQQLQEELTSWNE KVTGLVGLLNSEI NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atgagccttgaattactgtccaaactggaaaccaaaatccaggctgcactcgaaacgatc gagcttctaaaaatggagcttgaagaagagaagcaaaaagcgtctacgctgagtgagcac aatcaacaattgaatgcgcaaaaccagcaactacaagaagaactcacttcttggaacgaa aaagttactggccttgttggcttgttaaacagcgaaatctaa

DBGET integrated database retrieval system