Shewanella bicestrii: CF168_01585 Help Entry CF168_01585       CDS       T05197                                  Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism sbj  Shewanella bicestrii Brite KEGG Orthology (KO) [BR:sbj00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:sbj03036]     CF168_01585 Chromosome and associated proteins [BR:sbj03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     CF168_01585 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB KASH_CCD Rootletin CC_BshC ATG14 Nuf2_DHR10-like CtIP_N Laminin_II ArsA_ATPase bZIP_2 DUF4757 YabA COG3_N KIP1 RmuC DUF3450 OmpH BBS7_hp SlyX Muted Tlp DivIC Mis12 NPV_P10 Prominin bZIP_1 K-box ERM_C Motif Other DBs NCBI-ProteinID:  ASK67651 UniProt:  A0A220UI89 LinkDB All DBs Position complement(333451..333672) Genome browser AA seq 73 aa AA seqDB search MSLELLSKLETKIQATLETIELLKMELEEEKQKTSTLSEQNQQLSEQNQQLQQELASWND KVTGLVGLLNSEI NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atgagccttgaattactgtccaaactggaaaccaagatccaggctacactcgaaactatc gagcttctaaaaatggagctagaggaagagaagcaaaagacgtcgaccttgagtgagcaa aatcaacaattatctgagcaaaaccaacaactgcaacaagaactcgcttcttggaacgac aaagtcaccggacttgttggcctgctcaacagtgaaatctaa

DBGET integrated database retrieval system