Sphingomonas cannabina: LZK98_11490 Help Entry LZK98_11490       CDS       T08607                                  Name (GenBank) HNH endonuclease   KO K07451   5-methylcytosine-specific restriction enzyme A [EC:3.1.21.-] Organism scab  Sphingomonas cannabina Brite KEGG Orthology (KO) [BR:scab00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02048 Prokaryotic defense system [BR:scab02048]     LZK98_11490 Prokaryotic defense system [BR:scab02048]  Restriction and modification system (R-M system)   Type IV R-M system    LZK98_11490 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  HNH HNH_5 Motif Other DBs NCBI-ProteinID:  UIJ43713 LinkDB All DBs Position 2427666..2427869 Genome browser AA seq 67 aa AA seqDB search MRARILIEEPLCRLCLEAGRISPTTIADHIIPKAEGGGDERSNYQGLCRPCHVAKTARES ARARRRR NT seq 204 nt NT seq  +upstreamnt  +downstreamnt atgagagcgcgcatcctgatcgaggagccactgtgccgcctgtgtcttgaggctgggcgc atctccccaaccaccatcgctgaccacatcatccccaaggctgaaggcggtggcgacgag cgcagcaactatcagggcctctgccggccctgtcatgtggcgaagacggcgcgcgagagc gcgcgggcgaggagacggcgatga

DBGET integrated database retrieval system