Streptomyces cathayae: PYS65_07030 Help Entry PYS65_07030       CDS       T09946                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism scay  Streptomyces cathayae Pathway scay00998   Biosynthesis of various antibiotics scay01100   Metabolic pathways scay01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:scay00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PYS65_07030    00074 Mycolic acid biosynthesis     PYS65_07030   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PYS65_07030 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  WGD39907 UniProt:  A0ABY8K0V1 LinkDB All DBs Position 1538592..1538846 Genome browser AA seq 84 aa AA seqDB search MATATREERLVVIKEIVCDILEIEEDEVSETSLFKEDHNADSLRAIEILAALEKEFGVVI NQSELPRMVNLTGVYEVVGEPAGW NT seq 255 nt NT seq  +upstreamnt  +downstreamnt atggccactgcaacgcgtgaagagcgtctcgtcgtcatcaaggaaatcgtctgcgacatt cttgagatcgaggaggacgaggtttcggaaaccagcctcttcaaggaggaccacaacgcc gactcgctgcgcgcgatcgagatcctcgcggcgctggaaaaggagttcggcgtggtcatc aaccagtccgaactgccgcgcatggtcaacctcacgggcgtgtacgaggtcgtaggggaa ccggccggctggtaa

DBGET integrated database retrieval system