Streptomyces scabiei: SCAB_69841 Help Entry SCAB_69841        CDS       T01187                                  Name (GenBank) conserved hypothetical protein   KO K02078   acyl carrier protein Organism scb  Streptomyces scabiei Pathway scb00998   Biosynthesis of various antibiotics scb01100   Metabolic pathways scb01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:scb00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SCAB_69841    00074 Mycolic acid biosynthesis     SCAB_69841   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SCAB_69841 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  CBG73978 UniProt:  C9YY76 LinkDB All DBs Position complement(7739458..7739742) Genome browser AA seq 94 aa AA seqDB search MAIMSTSTLDNEIREFVLTTVIDEMNILLSRDGITDESPVTVGGLELDSLSLIELTLRLE SRFGVEIPDTDIEPLASLTLGGLVSEVVGRGAKA NT seq 285 nt NT seq  +upstreamnt  +downstreamnt atggcgatcatgagcacgtccaccctggacaacgagatccgcgagttcgtcctgaccacg gtcatcgacgagatgaacatcctgctgagccgcgacggcatcacggacgagagcccggtg accgtcggcgggctggagctggactccctcagcctgatcgagctgacgctgcggctggag tcgcggttcggcgtggagatcccggacaccgacatcgagccgctggcctccctgaccctc ggcgggctcgtctccgaggtcgtcgggcgcggggcgaaggcatga

DBGET integrated database retrieval system