Sinorhizobium chiapasense: RB548_23895 Help Entry RB548_23895       CDS       T11111                                  Name (GenBank) aspartate 1-decarboxylase   KO K01579   aspartate 1-decarboxylase [EC:4.1.1.11] Organism schp  Sinorhizobium chiapasense Pathway schp00410   beta-Alanine metabolism schp00770   Pantothenate and CoA biosynthesis schp01100   Metabolic pathways schp01110   Biosynthesis of secondary metabolites schp01240   Biosynthesis of cofactors Module schp_M00119   Pantothenate biosynthesis, valine/L-aspartate => pantothenate Brite KEGG Orthology (KO) [BR:schp00001]  09100 Metabolism   09106 Metabolism of other amino acids    00410 beta-Alanine metabolism     RB548_23895   09108 Metabolism of cofactors and vitamins    00770 Pantothenate and CoA biosynthesis     RB548_23895 Enzymes [BR:schp01000]  4. Lyases   4.1  Carbon-carbon lyases    4.1.1  Carboxy-lyases     4.1.1.11  aspartate 1-decarboxylase      RB548_23895 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Asp_decarbox Motif Other DBs NCBI-ProteinID:  WVT06403 LinkDB All DBs Position pSchITTGS70c:258174..258407 Genome browser AA seq 77 aa AA seqDB search MLYGNAGSRCCILNGAAARTCQRRDEIMIASSTFCEVDDISSLKPRVLVFDPDRITHEVF RRPDGSLDLPVNSELVV NT seq 234 nt NT seq  +upstreamnt  +downstreamnt gtgctctatggcaacgcgggttccagatgctgtatcctcaatggcgccgccgcgcgcacc tgccagcggcgagacgagatcatgatcgcctcgagcaccttctgcgaggttgacgacatc agcagtctcaagccacgtgtcctcgtattcgatccggatcggattacccatgaggtgttc cgccgccccgacggttcgctcgatctgccggtcaacagcgagctcgtcgtgtag

DBGET integrated database retrieval system