Streptomyces cyaneochromogenes: EJ357_29975 Help Entry EJ357_29975       CDS       T06811                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism scya  Streptomyces cyaneochromogenes Pathway scya00253   Tetracycline biosynthesis scya01056   Biosynthesis of type II polyketide backbone scya01100   Metabolic pathways scya01110   Biosynthesis of secondary metabolites Module scya_M00778   Type II polyketide backbone biosynthesis, acyl-CoA + malonyl-CoA => polyketide Brite KEGG Orthology (KO) [BR:scya00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     EJ357_29975    00253 Tetracycline biosynthesis     EJ357_29975  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:scya01004]     EJ357_29975    01008 Polyketide biosynthesis proteins [BR:scya01008]     EJ357_29975 Lipid biosynthesis proteins [BR:scya01004]  Polyketide synthase   Component type    EJ357_29975 Polyketide biosynthesis proteins [BR:scya01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      EJ357_29975     Nonaketide PKS      EJ357_29975     Decaketide PKS      EJ357_29975 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  AZQ37154 UniProt:  A0A3S9MD95 LinkDB All DBs Position 6555229..6555489 Genome browser AA seq 86 aa AA seqDB search MATLLTIDDLRRILIECAGETDGTDLSGDILDTRFETIGYDSLALMETAARLESRYDVAI PDDIAARVDTPRELLDLVNGALAEAA NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atggcaaccctgctgaccatcgacgacctgcgccgcatcctcatcgaatgcgccggagag acggacggaacggacctgtccggcgacatcctcgacacccgcttcgagaccatcggctac gactcgctcgccctgatggagaccgcggcgcggctggagagccgctacgacgtggccatc cccgacgacatcgcggcccgcgtcgacacgccacgggaactgctcgacctggtcaacggc gcgctggccgaggcagcatga

DBGET integrated database retrieval system