Streptomyces cyaneochromogenes: EJ357_34770 Help Entry EJ357_34770       CDS       T06811                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism scya  Streptomyces cyaneochromogenes Pathway scya00253   Tetracycline biosynthesis scya01056   Biosynthesis of type II polyketide backbone scya01100   Metabolic pathways scya01110   Biosynthesis of secondary metabolites Module scya_M00778   Type II polyketide backbone biosynthesis, acyl-CoA + malonyl-CoA => polyketide Brite KEGG Orthology (KO) [BR:scya00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     EJ357_34770    00253 Tetracycline biosynthesis     EJ357_34770  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:scya01004]     EJ357_34770    01008 Polyketide biosynthesis proteins [BR:scya01008]     EJ357_34770 Lipid biosynthesis proteins [BR:scya01004]  Polyketide synthase   Component type    EJ357_34770 Polyketide biosynthesis proteins [BR:scya01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      EJ357_34770     Nonaketide PKS      EJ357_34770     Decaketide PKS      EJ357_34770 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AZQ37985 UniProt:  A0A3S9MFM5 LinkDB All DBs Position complement(7609494..7609751) Genome browser AA seq 85 aa AA seqDB search MSPFTLVDLKRILLEGAGADDGVDLDGEILDMEFVDLGYESLALLETSSRIEREYHISLD ESAMADVTTPRALIDLVNSHLAAAA NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgtccccgttcactctcgtcgacctcaagcggatcctcctcgaaggcgcgggcgccgac gacggcgtcgacctcgacggcgagatcctcgacatggagttcgtggatttgggctacgag tccctcgccctgctggagaccagcagccgcatcgagcgtgagtaccacatctcgctggac gagtcggcgatggccgacgtgacgacgccgcgcgcgctcatcgacctggtcaacagccac ctcgccgccgcggcctga

DBGET integrated database retrieval system