Streptomyces cyaneochromogenes: EJ357_43410 Help Entry EJ357_43410       CDS       T06811                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism scya  Streptomyces cyaneochromogenes Pathway scya00998   Biosynthesis of various antibiotics scya01100   Metabolic pathways scya01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:scya00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     EJ357_43410    00074 Mycolic acid biosynthesis     EJ357_43410   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     EJ357_43410 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  AZQ39440 UniProt:  A0A3Q9F084 LinkDB All DBs Position 9677485..9677730 Genome browser AA seq 81 aa AA seqDB search MNRTEAMDMVRESISRVLPGADVAALGPDDAFRDVLEMDSLDFLSFVEVLSERSGVRIED EDSRRLTTLSAAADFLAAHTR NT seq 246 nt NT seq  +upstreamnt  +downstreamnt atgaatcgaaccgaggcaatggacatggtcagggaatcgatctcccgcgtccttccgggc gccgacgtcgcagctctggggcccgacgacgcgttccgcgatgtactggagatggactcg ctggacttcctgagtttcgtggaggtgctcagcgagcgctccggcgtgcgcatcgaggac gaggactcgcgccggctcaccacgctgtccgccgccgccgacttccttgccgcccacacg cggtga

DBGET integrated database retrieval system