Stenotrophomonas cyclobalanopsidis: AB1723_09305 Help Entry AB1723_09305      CDS       T10607                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism scyc  Stenotrophomonas cyclobalanopsidis Pathway scyc01100   Metabolic pathways scyc01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:scyc00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AB1723_09305    00074 Mycolic acid biosynthesis     AB1723_09305   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AB1723_09305 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Cyclase WHD_DprA Motif Other DBs NCBI-ProteinID:  XCZ89295 LinkDB All DBs Position complement(1975617..1975859) Genome browser AA seq 80 aa AA seqDB search MSALTLTQVRECIAAHLGHSVAGVGAHQRLAEDLDIDSLALHAVLLDLEEAGGVLPEPGA MAQVVTVADLHRALVADHAP NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgagcgcgctcaccctgactcaggtacgcgaatgcatcgcagcccacctcggccattcc gtggccggggtgggcgcgcatcagcgcctggccgaagatctggacatcgattcgctggcc ctccatgcggtgctgctggacctggaagaggccggcggcgtactgcctgagccgggtgcg atggcccaggttgtcaccgtcgcggacctgcaccgtgccctggtggcggaccacgcaccg tga

DBGET integrated database retrieval system