Streptomyces cyaneofuscatus: R2B67_24755 Help Entry R2B67_24755       CDS       T09646                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism scye  Streptomyces cyaneofuscatus Pathway scye00253   Tetracycline biosynthesis scye01056   Biosynthesis of type II polyketide backbone scye01100   Metabolic pathways scye01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:scye00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     R2B67_24755    00253 Tetracycline biosynthesis     R2B67_24755  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:scye01004]     R2B67_24755    01008 Polyketide biosynthesis proteins [BR:scye01008]     R2B67_24755 Lipid biosynthesis proteins [BR:scye01004]  Polyketide synthase   Component type    R2B67_24755 Polyketide biosynthesis proteins [BR:scye01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      R2B67_24755     Nonaketide PKS      R2B67_24755     Decaketide PKS      R2B67_24755 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  WOP11544 LinkDB All DBs Position 5634329..5634598 Genome browser AA seq 89 aa AA seqDB search MAPQEFTHADLKRILLEGAGAEEGVDLDGDILDTDFEALGYESLALLETAGRIEREFGLS LEDDVFVTHPTPRALTAAVNAVLRSDVTA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atggcccctcaggaattcacccatgccgacctcaagcgcatcctcctcgaaggagccggt gccgaggagggcgtcgacctcgacggcgacatcctcgacaccgatttcgaggcgctcgga tacgagtcactggccctgctggagaccgcgggtcgcatcgagcgggagttcggcctctcg ctggaggacgacgtcttcgtcacgcaccccacgccccgcgccctgacggcggccgtcaac gccgtcctccgcagcgacgtgaccgcgtag

DBGET integrated database retrieval system