Streptomyces dengpaensis: C4B68_09605 Help Entry C4B68_09605       CDS       T06611                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism sdx  Streptomyces dengpaensis Pathway sdx00253   Tetracycline biosynthesis sdx01056   Biosynthesis of type II polyketide backbone sdx01100   Metabolic pathways sdx01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sdx00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     C4B68_09605    00253 Tetracycline biosynthesis     C4B68_09605  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:sdx01004]     C4B68_09605    01008 Polyketide biosynthesis proteins [BR:sdx01008]     C4B68_09605 Lipid biosynthesis proteins [BR:sdx01004]  Polyketide synthase   Component type    C4B68_09605 Polyketide biosynthesis proteins [BR:sdx01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      C4B68_09605     Nonaketide PKS      C4B68_09605     Decaketide PKS      C4B68_09605 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AVH55984 UniProt:  A0ABM6SMT2 LinkDB All DBs Position 2118783..2119052 Genome browser AA seq 89 aa AA seqDB search MSDREFTLDDLRRILRDGAGADEAVDLDGDILDAEFESLGYESLALLETSSRIEREFGIT LDDDTVTEAKTPRALIDAVNSFLVPARSS NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgtccgaccgcgagttcaccctcgacgaccttcggcgcattctgcgcgacggggcaggc gccgacgaggccgtcgacctggacggcgacattctcgacgccgagttcgagtcgctcgga tacgagtccctggccctgctggagaccagcagccgtatcgagcgcgagttcggcatcacc ctcgacgacgacacggtgacggaggcgaagacgccgcgcgccctgatcgacgccgtcaac tccttcctggtgcccgcccgttccagctga

DBGET integrated database retrieval system