Selenomonas sp. oral taxon 478: ADJ74_00490 Help Entry ADJ74_00490       CDS       T04017                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism sele  Selenomonas sp. oral taxon 478 Pathway sele00998   Biosynthesis of various antibiotics sele01100   Metabolic pathways sele01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sele00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ADJ74_00490    00074 Mycolic acid biosynthesis     ADJ74_00490   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ADJ74_00490 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF1493 Ribosomal_L12_N Ribosomal_L50 DUF7080 Motif Other DBs NCBI-ProteinID:  AKT53043 UniProt:  A0A0K1FEW0 LinkDB All DBs Position 1:complement(91674..91904) Genome browser AA seq 76 aa AA seqDB search MATFDKVRDIVVEQLGSEADEVTLESTFIDDLGADSLDIVELIMAFEEEFNVEIPDEAAE KIKTVQDVVNYIDQHK NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atggcaacgtttgacaaggttcgcgacattgtcgttgagcagcttggctcggaggctgat gaggtcaccttggagtcgacgtttattgacgatcttggtgctgattccctcgacatcgtt gagctcatcatggcatttgaggaagagtttaacgtcgagatccctgatgaggctgctgag aagatcaagacggttcaggatgtcgtcaattacatcgaccagcacaagtaa

DBGET integrated database retrieval system