Selenomonas sp. TAMA-11512: TAMA11512_18590 Help Entry TAMA11512_18590   CDS       T10655                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism selm  Selenomonas sp. TAMA-11512 Pathway selm00998   Biosynthesis of various antibiotics selm01100   Metabolic pathways selm01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:selm00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     TAMA11512_18590 (acpP)    00074 Mycolic acid biosynthesis     TAMA11512_18590 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     TAMA11512_18590 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C Ribosomal_L50 Ribosomal_L12_N DUF1493 Motif Other DBs NCBI-ProteinID:  BEU88395 LinkDB All DBs Position complement(1945867..1946097) Genome browser AA seq 76 aa AA seqDB search MATFEKVRSIVVEQLGVEADEVSLESTFIDDLGADSLDIVELIMAFEEEFGVEIPDESAE KIKTVQDVVTYIDQNK NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atggcaacatttgaaaaggtgaggagtattgttgttgagcagctcggtgttgaggctgat gaggtttcgctcgagtccacgttcattgacgatctgggtgctgattccttggacattgtc gagctgatcatggcatttgaggaggagttcggagttgaaattccggatgagtccgctgag aagatcaagacggttcaggatgttgtaacctacattgaccagaacaagtaa

DBGET integrated database retrieval system