Serratia entomophila: KHA73_19375 Help Entry KHA73_19375       CDS       T08209                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism senp  Serratia entomophila Pathway senp01100   Metabolic pathways senp01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:senp00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     KHA73_19375    00074 Mycolic acid biosynthesis     KHA73_19375   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     KHA73_19375 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  UIW17558 LinkDB All DBs Position complement(4003900..4004142) Genome browser AA seq 80 aa AA seqDB search MKKYHVLYEAVCAMLSEAREVEPASLSADMPLRQLGLDSLDYVELMLLAQRSFGISLKAE MFIEQPDLTLGELCHYMAAQ NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgaaaaagtaccacgttttgtatgaggccgtttgcgccatgctgtccgaggcgagggaa gtggagccggcgtcgctgtcggcggatatgcctctgcggcagctgggtctggacagcctg gattatgtggagctgatgctgttggcgcagcggagcttcggtatttcactcaaggctgaa atgtttattgagcagcctgatttgacgttgggggagctgtgccattatatggccgcgcaa taa

DBGET integrated database retrieval system