Sorex fumeus (smoky shrew): 130044136 Help Entry 130044136         CDS       T10594                                  Name (RefSeq) metallothionein-2A   KO K14739   metallothionein 1/2 Organism sfum  Sorex fumeus (smoky shrew) Pathway sfum04978   Mineral absorption Brite Messenger RNA biogenesis [BR:sfum03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      130044136 Mitochondrial biogenesis [BR:sfum03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     130044136 BRITE hierarchy SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  130044136 NCBI-ProteinID:  XP_055992710 LinkDB All DBs Position Unknown AA seq 61 aa AA seqDB search MDPNCPCSTGGACTCAGPCKCKDCKCSSSKKSCCSCCPAGCAKCAKGCVCKGASDKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgcccctgctccactggcggcgcctgtacctgcgctggcccctgtaag tgcaaagactgcaaatgcagcagctccaagaaaagctgctgctcctgctgtcccgcgggc tgtgccaagtgcgccaagggttgtgtgtgcaaaggcgcgtctgacaagtgcagctgctgc gcctga

DBGET integrated database retrieval system